Locus Details
* This submission has not yet been processed.
| MENotes Database ID | 33495 |
|---|---|
| Taxon | Silene latifolia (Caryophyllaceae) |
| Locus Name | SlX1 ( All species amplified... ) |
| Marker Type | microsatellite |
| Genome | Not Provided |
| Original Species | Not Provided, Genbank ID AY084036.1 |
| Publication Reference | Molecular Ecology Resources (2009) 8:1274-1276 |
| Contact Information | Roman Hobza hobza@ibp.cz |
| Forward Primer (5'–3') | CGAGGCATCTATCTGGGACA |
| Reverse Primer (5'–3') | CGGCAACTAAATGGTCAGATG |
| Annealing Temperature | 55°C |
| Number of Alleles | 2 |
| Size Range | 387 |
| Expected Heterozygosity | Not Provided |
| Observed Heterozygosity | Not Provided |
| Notes | After denaturation at 94°C for 2 min, cycling was performed for 35 cycles under the following conditions: 30 s at 94°C, 45 s at 55°C and 45 s at 72°C and a final extension step for 5 min at 72°C. |