Locus Details
* This submission has not yet been processed.
| MENotes Database ID | 33310 |
|---|---|
| Taxon | Persea americana (Lauraceae) |
| Locus Name | SHRSPa075 ( All species amplified... ) |
| Marker Type | microsatellite , Repeat Motif = AGGG(GA)9AAGA |
| Genome | Not Provided |
| Original Species | Yes, Genbank ID 209133 1 |
| Publication Reference | Molecular Ecology Resources (2009) 7:439-444 |
| Contact Information | Raymond Schnell Ray.Schnell@ARS.USDA.GOV |
| Forward Primer (5'–3') | CTGCTGCGACTCCATCTCTGC |
| Reverse Primer (5'–3') | GCCACCTGCTTCTTCTTCTTCTTC |
| Annealing Temperature | 56°C |
| Number of Alleles | 9 2 |
| Size Range | 117-306 |
| Expected Heterozygosity | Not Provided |
| Observed Heterozygosity | Not Provided 3 |
| Notes |
1. Accession number given from the Plant Genome Network (htt://pgn.cornell.edu/) 2. Marker amplified at 4 loci 3. Marker used in a mapping population |